circad | circRNAs associated with diseases

Circular RNA 0068669
Gene		Organism	Human
Genome Locus		Build	hg19
Disease	Hepatocellular Carcinoma	ICD-10	Liver cell carcinoma (C22.0)
DBLink		PMID	29785842
Experimental Method
Sample Type	Tissue and cell lines	Comparison	HCC tissues and adjacent non-tumorous tissues
Method for Estimation	Quantitative PCR	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward ACAGTCAGAAAGCCTCTCCAG Reverse GCCTCCAAACCCAGTATTCCAT	Statistics	Fold Change : Downregulated pvalue : <0.05
Citation
Yao, T, Chen, Q, Shao, Z, Song, Z, Fu, L, Xiao, B (2018). Circular RNA 0068669 as a new biomarker for hepatocellular carcinoma metastasis. J. Clin. Lab. Anal., 32, 8:e22572.